Ttc11/fis1

Author: lxpn

August undefined, 2024

WebFIS1 (a.k.a. CGI-135, TTC11) Cloning Information Cloning method Gibson Cloning 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG 3′ sequencing primer ATAGCGTAAAAGGAGCAACA (Common Sequencing Primers) Terms and Licenses. Academic/Nonprofit Terms. UBMTA; Institut Pasteur Label License for ... WebTTSEC You Invest. We protect. Everyone Benefits!

abclonal.com

WebPrimePCR™ PreAmp for SYBR® Green Assay: FIS1, Human Reaction: 400 reactions Gene-specific PCR ... TTC11 is a component of a mitochondrial complex that promotes … WebMitochondrial fission 1 protein (FIS1) is a protein that in humans is encoded by the FIS1 gene on chromosome 7. It is mapped to 7q22.1. The balance between fission and fusion … gluten free restaurants in jackson tn

Mouse FIS1/TTC11 qPCR Primer Pair Sino Biological

WebAnti-FIS1 antibodies are offered by a number of suppliers. This target gene encodes the protein 'fission, mitochondrial 1' in humans and may also be known as CGI-135, TTC11, mitochondrial fission 1 protein, and FIS1 homolog. Structurally, the protein is reported to be 16.9 kilodaltons in mass. WebAll lanes : Anti-TTC11/FIS1 antibody [EPR8412] (ab156865) at 1/10000 dilution (Purified) Lane 1 : Jurkat (Human T cell leukemia T lymphocyte) whole cell lysate Lane 2 : Raji … WebJan 22, 2024 · TTC11 is a component of a mitochondrial complex that promotes mitochondrial fission (James et al., 2003 [PubMed 12783892]).[supplied by OMIM, Mar … boldric knife bag

Anti-TTC11/FIS1 antibody (ab71498) Abcam

Purified anti-FIS Antibody, FIS, Poly28613

WebPrimePCR™ PreAmp for SYBR® Green Assay: FIS1, Human Reaction: 400 reactions Gene-specific PCR ... TTC11 is a component of a mitochondrial complex that promotes mitochondrial fission (James et al. 2003 [PubMed 12783892]).[supplied by … WebFis1 (fission 1) is an integral mitochondrial outer membrane protein that participates in mitochondrial fission by interacting with dynamin-related protein 1 (Drp1). Excessive mitochondrial fission is associated with the pathology of a number of neurodegenerative or neurodevelopmental diseases. Increased expression of Fis1 has been found in ... boldrey sensory cortexWebFeb 24, 2024 · Fis1 Antibody (B-5) is an IgG 2a κ mouse monoclonal Fis1 antibody (also designated FIS-1 antibody, fission, mitochondrial 1 antibody, tetratricopeptide repeat domain 11 antibody, TTC11 antibody, or CGI-135 ORF antibody) suitable for the detection of the Fis1 protein of mouse, rat and human origin by WB, IP, IF, IHC(P) and ELISA. Fis1 … boldric knives

"WebThis product is manufactured by BioVision, an Abcam company and was previously called 3491R Fis1 Polyclonal Antibody. The Life Science industry has been in the grips of a … " - Ttc11/fis1

Ttc11/fis1

TTSEC You Invest. We protect. Everyone Benefits!

WebBoster Bio Anti-TTC11/FIS1 Antibody catalog # A01932-2. Tested in ELISA, Flow Cytometry, IF, IHC, ICC, WB applications. This antibody reacts with Human, Mouse, Rat. Supplied as … WebFIS1. TTC11, CGI-135. fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae) GO Process (18) GO Function (2) GO Component (6) Gene Ontology Biological Process. calcium-mediated signaling using intracellular calcium source ; mitochondrial fission [IDA, IMP]

Did you know?

WebApr 8, 2024 · Although there were changes in the FIS1 protein expression in T12, Mnf2 expression, the caspase-9 activity and the intracellular ATP content in T10 and the caspase-9 and caspase-3 activity in T11 ... WebAll lanes : Anti-TTC11/FIS1 antibody - N-terminal (ab189846) at 1/500 dilution Lane 1 : 293T cell line extract Lane 2 : HepG2 cell line extract Lane 3 : A549 cell line extract Lane 4 : …

WebAnti-TTC11/FIS1 antibody (ab286127) Datasheet. SDS. Submit a review Submit a question. $670 Product size. 100 µg. Add to basket. The lead time on this item is currently 1-2 … WebAnti-TTC11/FIS1 antibody. ab96764 is a primary antibody from Abcam. 23 Citations Host: Rabbit Clonality: Polyclonal Validations: None Available Applications: WB, IHC and 2 more Reactivity: Homo sapiens (Human), Mus musculus (House mouse) and 2 more TTC11 Antibody. NB100-56646 is a primary antibody from Novus Biologicals.

WebFIS1 - fission, mitochondrial 1. The balance between fission and fusion regulates the morphology of mitochondria. TTC11 is a component of a mitochondrial complex that promotes mitochondrial fission (James et al., 2003 [PubMed 12783892]). [supplied by OMIM, Mar 2008] Genes similar to FIS1. WebFis1, a 17KDa integral membrane protein, is a novel member of mitochondrial fission machinery. It consists of a central leucine-zipper domain, a coiled-coil region, a tetratricopeptide repeat domain and a C-terminal transmembrane domain. It is a human orthologue of Fis1p (S.cerevisiae) and is localized in the outer mitochondrial membrane.

Web寻找 Abcam 抗体及试剂 - Abcam中文官网

WebGene_name： FIS1 TTC11 CGI-135 Protein_name： Mitochondrial fission 1 protein (FIS1 homolog) ... P84817 Immunogen： Synthesized peptide derived from human FIS1 Specificity： This antibody detects endogenous levels of human FIS1 Formulation： Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. Source： Rabbit … gluten free restaurants in fort wayne indianaWeb(ab156865) Anti-TTC11/FIS1 antibody [EPR8412] - Abcam - CiteAb. 16 citations – A rabbit monoclonal antibody, raised against Mitochondrial fission 1 protein (Human), supplied by Abcam. ... FIS1 homolog, Tetratricopeptide repeat protein 11, FIS1_HUMAN. UniProt Code History Q9BTP3, Q9Y3D6. Gene Synonyms FIS1, TTC11, CGI-135. gluten free restaurants in kyoto gluten free restaurants in jim thorpe paWebMitochondrial fission 1 protein, FIS1, Tetratricopeptide repeat protein 11, TPR repeat protein 11, TTC11, FIS1 Homolog, Fission, Mitochondrial 1, hFIS1 Isotype Rabbit Polyclonal IgG Ave. Rating Submit a Review Product Citations publications. Western blot of ... boldr impact addressWebMar 6, 2024 · Immunohistochemistry (Formalin/PFA-fixed paraffin-embedded sections) analysis of human kidney tissue sections labeling TTC11/FIS1 with Purified ab156865 at … gluten free restaurants in icelandWebMar 21, 2024 · TTC11 is a component of a mitochondrial complex that promotes mitochondrial fission (James et al., 2003 [PubMed 12783892]).[supplied by OMIM, Mar … bold rightingWebCD51 + CD61 (Integrin alpha V + Integrin beta 3) CD51 / Integrin alpha V. CD52 gluten free restaurants in jersey city nj