C1orf27

Author: skrg

August undefined, 2024

WebIn addition, we demonstrate that C1orf27 depletion attenuates the export of β 2-AR and dopamine D2 receptor but not of epidermal growth factor receptor. We further show that … WebC1orf27 ( a.k.a. ODR4, TTG1, odr-4) Promoter U6 Cloning Information Cloning method Restriction Enzyme 5′ cloning site BsmBI (destroyed during cloning) 3′ cloning site BsmBI (destroyed during cloning) 5′ sequencing primer CCCAGAGAGGGCCTATTTCCCA (Common Sequencing Primers) Terms and Licenses Academic/Nonprofit Terms UBMTA

C1orf27 interaction with α 2A -AR and identification of the ...

WebFeb 14, 2024 · CHROMOSOME 1 OPEN READING FRAME 27; C1ORF27 HGNC Approved Gene Symbol: ODR4 Cytogenetic location: 1q31.1 Genomic coordinates (GRCh38): 1:186,375,838-186,435,031 (from NCBI) TEXT Cloning and Expression refresher biscuits

Addgene: LentiCRISPR-sgC1orf27-2

WebC1orf27 human Fusion Protein 6*His from Proteintech. Produced in E.coli-derived, PET28a, with high quality purity. Cat.No. Ag18869 WebFeb 5, 2024 · odr-4 GPCR localization factor homolog. Gene ID: 54953, updated on 5-Feb-2024. Gene type: protein coding. Also known as: TTG1; odr-4; C1orf27. See all available … WebDownload scientific diagram CRISPR-Cas9-mediated C1orf27 KO suppresses α 2A -AR export from the ER to the Golgi and the cell surface. A and B, inhibition of ER-Golgi transport of α 2A -AR in ... refresher bathroom

Human C1orf27 protein interacts with α2A …

WebChromosome 1 is the designation for the largest human chromosome.Humans have two copies of chromosome 1, as they do with all of the autosomes, which are the non-sex chromosomes.Chromosome 1 spans about 249 million nucleotide base pairs, which are the basic units of information for DNA. It represents about 8% of the total DNA in human cells. WebThe length of the C2orf27 protein sequence is 203 a.a. in length and has a molecular weight of 21.5 kDa with a pI of 5.13 in Homo sapiens. [4] [5] When taking into account the … refresher at starbucksWebMar 21, 2024 · C1orf27 Search aliases for ODR4 gene in PubMed and other databases Summaries for ODR4 Gene Entrez Gene Summary for ODR4 Gene Predicted to be … refresher bls aed

"WebApr 17, 2024 · C1orf27 is a human homolog of odorant response abnormal 4 which was originally identified as an endoplasmic reticulum (ER) membrane protein to regulate the … " - C1orf27

C1orf27

Ubiquitously expressed GPCR membrane-trafficking orthologs

WebPlasmid pMXs-HA-C1orf27 from Dr. David Sabatini's lab contains the insert C1orf27 and is published in Cell. 2024 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2024.01.013. This plasmid is available through Addgene. Image: Illustrated plasmid map in PNG format. WebC1ORF27 has 3,643 functional associations with biological entities spanning 8 categories (molecular profile, organism, chemical, functional term, phrase or reference, disease, …

Did you know?

Web3027F, Under Diagnostic/Screening Processes or Results. The Current Procedural Terminology (CPT ®) code 3027F as maintained by American Medical Association, is a … WebJan 29, 2024 · Enables RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Acts upstream of or within several processes, including animal organ …

WebMay 9, 2024 · C1orf27 is a human homolog of ODR4 and ubiquitously expressed ( 27 ). C. elegans ODR4 and human C1orf27 share only 22% identity and 44% similarity. Recent … WebGene Symbol: C1ORF27; Aliases: Not Available: RefSeq: Not Available: Ensembl: ENSMMUG00000009085 : Entrez: 0 : UniGene: Not Available: Why PrimePCR? PrimePCR Lookup Tool. Design and Validation of Real-Time PCR Primers-test ® Pathway Curation ...

WebC1orf27 is a human homolog of ODR4 and ubiquitously expressed (27). C. elegans ODR4 and human C1orf27 share only 22% identity and 44% similarity. Recent studies suggest … WebAnti-C1orf27 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody; Synonyms: FLJ20505,TTG1,odr-4; find Sigma-Aldrich-HPA031352 MSDS, related peer-reviewed papers, technical documents, similar products & more at Sigma-Aldrich

WebAnti C1orf27 pAb [Catalog No.: ATL-HPA031352]

WebHuman C1orf27 protein interacts with α2A-adrenergic receptor and regulates its anterograde transport Article Full-text available May 2024 Xin Xu Guangyu Wu The molecular mechanisms underlying the... refresher bomb drinkWebC1ORF27. ODR4, TTG1, odr-4. chromosome 1 open reading frame 27. GO Process (0) GO Function (0) GO Component (0) CRISPR Database VEGA HGNC Alliance of Genome Resources OMIM Entrez Gene RefSeq UniprotKB Ensembl HPRD . Download Curated Data for this Protein. 120291. 9606. Interaction Statistics. High Throughput. 104. refresher bomb shotWebFeb 3, 2024 · C1orf27 is predicted to have a C-terminal transmembrane anchor, which may serve to tether it and UFSP2 to the ER surface (Figure S3 A). Consistent with this model, … refresher bombWebMar 21, 2024 · Human C1orf27 protein interacts with alpha2A-adrenergic receptor and regulates its anterograde transport. LMO2, TAL1, Ttg-1, and SIL support levels of V(D)J … refresher bookkeeping courseWebUncharacterized protein Chromosome 1 Open Reading Frame 27 is a protein in humans, encoded by the C1orf27 gene. It is accession number NM_017847. This is a membrane protein that is 3926 base pairs long with the most extensive string of amino acids being 454aa long. C1orf27 exhibits cytoplasmic expression in epidermal tissues. refresher books for class 10WebMar 21, 2024 · GeneCards Summary for C1orf127 Gene. C1orf127 (Chromosome 1 Open Reading Frame 127) is a Protein Coding gene. Diseases associated with C1orf127 … refresher boxxWebGene Symbol: C1ORF27; Aliases: Not Available: RefSeq: Not Available: Ensembl: ENSMMUG00000009085 : Entrez: 0 : UniGene: Not Available: Why PrimePCR? … refresher calories